Login   /   Register
Yao, Wu, Yao, Li, Ren, and Chi: The response mechanism of the HVA1 gene in hulless barley under drought stress

The response mechanism of the HVA1 gene in hulless barley under drought stress

Abstract

HVA1, a member of LEA3 (late embryogenesis abundant protein, group 3), is closely related to water stress. However, the response of HVA1 to drought remains unknown in hulless barley. In this study, cultivars with high (Handizi), intermediate (Kunlun 12), and low (Dama) drought tolerance were selected from 28 hulless barley cultivars from the Tibet-Qinghai plateau to explore the drought response mechanism of HVA1. Then, HVA1 was cloned and the expression of the three cultivars was studied using exposure to polyethylene glycol (PEG) 6000. HVA1s in the three hulless barleys were highly homologous at the nucleotide and amino acid levels with over 99% identity. Real-time quantitative polymerase chain reaction showed that the expression level of HVA1 induced by PEG 6000 had a single peak curve in the three cultivars, but higher HVA1 transcript accumulation was seen in Handizi than in Kunlun 12 and Dama under the same drought stress. This result was also proved in eight hulless barleys. The expression level was a better predictor of drought resistance than the genetic structure of HVA1.




Introduction

Hulless barley (Hordeum vulgare L. var. nudum Hook. f.) is a selfing annual species, with naked grains when ripening. It is widely grown on the Qinghai-Tibet plateau (suffering serious drought stress) and has been a staple food for the Tibetan people since the fifth century CE (Liang et al., 2012). Drought is an important environmental constraint that limits the productivity of barley and other crops worldwide (Romanek et al., 2011). The growth and development of plants are restrained under the stress of drought with decreases in net photosynthetic rate, respiration, leaf osmoregulation ability, and cell membrane stability (Li et al., 2016). The most susceptible stages to drought are germination, early seedling growth, and grain filling. If plants can survive drought stress during these sensitive periods, the ability of the plant to survive additional drought exposure will increase (Liang et al., 2016).

Plants have developed many physiological and biochemical reactions in response to adverse environmental conditions. Some compatible low-molecular-weight metabolites will be accumulated to protect cells against dehydration, and the most common of these is late embryogenesis abundant protein (LEA) (Park et al., 2003). LEA proteins are closely related to desiccation induced and regulated by abscisic acid (ABA) or dehydration signaling (Ramanjulu and Bartels, 2002). LEA proteins are involved in protection mechanisms against environmental stressors in plants (Liang et al., 2013). According to the homology of the amino acid sequence and presence of special primitive sequences, LEA proteins are categorised into six groups (Wise, 2003). The Hordeum vulgare aleurone1 (HVA1) gene, which belongs to group 3 LEA, is activated during cell dehydration caused by water deficit, salt stress, low temperature, or ABA induction (Romanek et al., 2011; Battaglia et al., 2008)

Most researches on the HVA1 have focused on transformation. The HVA1 plays a protective role against water tolerance in rice (Babu et al., 2004), wheat (Chauhan and Khurana, 2011), oats (Oraby et al., 2005), tobacco (Li et al., 2007) and mulberry (Checker et al., 2012). HVA1 resists water stress by increasing the dry weight of plant, the fresh weight of the roots, and the dry weight of the shoots in transgenic wheat (Sivamani et al., 2000). Crops transformed by the introduction of the barley HVA1 had a significant increase in vegetative biomass and other traits associated with drought tolerance. However, the expression pattern and the mechanism of HVA1 under drought stress in hulless barley remain unknown.

Materials and methods

Plant materials and growth conditions

The 28 hulless barley cultivars were selected from 300 cultivars, which collected from several major planting provinces including Qinghai, Tibet, and Sichuan. Selection was based on high yield and disease-resistance (Table 1). The cultivars were divided into three groups based on geographic origin: Qinghai-Tibet Plateau (19 cultivars), Hunan and Jiangsu provinces of China (5 cultivars), and Mexico (4 cultivars). The cultivars were archived by the Qinghai Academy of Agricultural Forestry Sciences. Seeds were grown in 100 mm petri dishes with three layers of filter paper saturated with 10 mL of distilled water for 7 d with sufficient additional water added to maintain saturation. Seedlings were transplanted into a 100 mL breaker (10 plants per breaker) with 20 mL distilled water. The seedlings were maintained in an incubator at 25°C with 2000 lx lighting intensity and a 14 h:10 h light:dark photoperiod.

Detection of relative water content and relative water loss rate

When the third leaves of 28 hulless barley varieties were fully expanded (15 d after sowing), they were removed to measure the relative water content and dehydration rate according to a previously described protocol (Chapotin et al., 2003). We used the following formula: Relative water content (RWC) (%)=[(Fresh quality– Dry quality)/(Saturated quality–Dry quality)] × 100%; Relative water loss rate (RWL) (g・g-1DW・h-1)=(Fresh quality– quality after 24 h dehydration)/(Dry quality × 24).

Polyethylene glycol 6000 treatment

Based on the RWC and RWL results, Handizi, Kunlun 12, and Dama were selected for further experiments. These three cultivars were treated with different concentrations (0, 5, 10, 15, 20, 25, and 30%) of polyethylene glycol (PEG) 6000 (Sigma Aldrich, Saint Louis, MO, USA) at the three-leaf stage in an incubator at 25oC with 2000 lx lighting intensity and a 14h:10h light:dark photoperiod. Sufficient PEG 6000 solution was added to each dish every day so that simulated drought conditions could be maintained for 3 d. Then the relative conductivity and malondialdehyde content of leaves were measured according to Karami et al. (2013), while the soluble protein content of leaves was determined according to Bradford (1976).

Isolation of the HVA1

Total RNA was extracted from the leaf tissues of Handizi, Kunlun 12 and Dama using MiniBEST Plant RNA Extraction Kit (TaKaRa, Kusatsu, Japan). The integrity of RNA was determined by electrophoresis on a 1.0% formaldehyde-denatured agarose gel stained with Gold View. The quality and quantity of RNA was determined by measuring the OD260/280 and OD260 with a SmartSpec Plus spectrophotometer (Bio-Rad, Hercules, CA, USA). The cDNA was synthesised using Superscript First-Strand Synthesis System for RT-PCR (TaKaRa) and an adaptor-oligo (dT) primer following manufacturer instructions. Primers were designed and used to amplify the cDNA of the HVA1gene (Table 2). Primers (P1) were designed to amplicate HVA1 according to the sequence in GenBank (ID: X78205.1). The PCR amplification conditions were 94°C for 5 min followed by 30 cycles at 94°C for 1 min; 64°C for 40 s; 72°C for 1 min and a final 72°C for 8 min. The PCR products were cloned into the pMD20-T vector (TaKaRa), and then transformed into E. coli DH5α. Five positive clones were sent for sequencing.

Semi-quantitative polymerase chain reaction and quantitative real-time polymerase chain reaction

Total RNA was extracted from the leaves of Handizi, Kunlun 12 and Dama which were soaked in 0 to 30% PEG 6000 for 3 d. The total RNA was then reverse transcribed into cDNA as a template for PCR. The semi-quantitative PCR primers of HVA1 were P1. Primers (P2) of reference gene β-actin were designed according to barley actin (ID: AY145541). The cycling parameters of semiquantitative PCR amplification were: 95°C for 5 min followed by 32 cycles at 94°C for 60 s, 64°C for 60 s, 72°C for 90 s and a final 72°C for 10 min. The quantitative real-time PCR primers (P3) were designed according to the HVA1 and the primers (P4) of the reference gene were designed from 18S rRNA. The qPCR amplification conditions were 95°Cfor 3 min followed by 40 cycles at 95°C for 10 s, 61°C for 30 s, then 95°C for 1 min, 61°C for1 min and a final 40 cycles at 61°C for 10s. The fluorescence signals obtained were measured once for each cycle at the extension step. All the reactions were performed in a DNA Engine OpticonTM 2 system (Bio-Rad) following manufacturer recommendations.

Data analysis

All physiological and gene expression measurements were replicated at least three times with independent plant samples and the mean was used for result analysis and discussion. Means, standard deviation (SD) and statistical analysis were performed using SPSS package (version 18.0). All data were subjected to variance analysis (ANOVA) and the mean differences were compared by the least significant difference (LSD) test. Nucleotides and amino acid sequence analyses were performed with the DNAMAN program version 5. 2. 2 (Lynnon Corp., San Ramon, CA, USA). 2-ΔΔCT methods were used in quantifying the relative changes of gene expression (Pfaffl, 2001).

Results

Identification of drought resistance in hulless barley cultivars

The RWC and RWL results of the 28 cultivars showed that the relative water content was the highest (60.16%) and the relative water loss rate was the lowest (8.80%) in Handizi, and the relative water content was the lowest (38.98%) and the dehydration rate was the highest (20.20%) in Dama (Figure 1A). These two parameters in Kunlun 12 were intermediate. The results suggested that Dama was the most sensitive to water loss stress and Handizi was the least sensitive, with Kunlun 12 being intermediate. Dama, Kunlun 12 and Handizi were selected for the next experiments.

We detected the RWC and ABA content of Kunlun 12 with PEG 6000 treatment. With increasing PEG 6000 concentration, the leaf RWC of Kunlun 12 gradually decreased (Figure 1B) and ABA content initially increased and then decreased (Figure 1C). The relationship between RWC and PEG 6000 concentration was linear, while the ABA content and PEG 6000 concentration relationship was a non-linear quadratic function. Therefore, it is possible to use PEG 6000 as an osmotic agent to simulate drought and water stress. The effects of PEG 6000 on leaf soluble protein content, relative conductivity, and malondialdehyde content were determined in Handizi, Kunlun 12, and Dama cultivars. The soluble protein content of the three cultivars initially increased and then decreased with increasing PEG 6000 concentration (Figure 2A). Compared with the control group, the protein content increased significantly at 5-15% PEG 6000 in Handizi and Kunlun 12, but decreased at 20-30% PEG 6000 in all three cultivars (P<0.01). However, in each group, the soluble protein content of Handizi was the highest, followed by Kunlun 12 and Dama. The results of relative conductivity and the malondialdehyde content were opposite those of the soluble protein content, with Handizi being the lowest, Kunlun 12 intermediate, and Dama the highest (Figure 2B and C). These results indicated that Handizi was the best drought-resistance cultivar, followed by Kunlun 12 and Dama.

Cloning and multiple sequence alignment of HVA1s from three cultivars

The cDNA sequences of the three HVA1s were 642 bp (Figure 3). Each of the cDNA sequences encoded 213 amino acids. Sequence comparison showed that the deduced amino acid sequence of HVA1-Handizi and HVA1-dama were identical, and HVA1- Kunlun12 was identical with them except for residue 197. Nine imperfect repeats of the 11 amino acids (Thr-Glu-Ala-Ala-Lys- Gln-Lys-Ala-Ala-Glu-Thr) were found in the three polypeptides.

Expression of the HVA1 in hulless barley using semiquantitative and quantitative polymerase chain reactions

The expression level of HVA1 in the three varieties was very low in distilled water and 5% PEG 6000. However, the expression was considerably greater in 10~30% PEG 6000 (Figure 4A). The expression of the HVA1 was detected by qPCR. The results showed that the expression of HVA1 was not significantly different in the control and 5% PEG 6000 groups, which is consistent with the semi-quantitative PCR results. The expression of HVA1 increased from 10% to 30% in the PEG 6000 group, and reached the highest level in the 20-25% PEG 6000 treatment in three cultivars. The expression level of the HVA1 in Handizi was the highest at each point, followed by Kunlun 12 and Dama, and the difference of expression level in the three cultivars was significant when treated with 10 to 30% solutions of PEG 6000. The highest expression level occurred at 25% PEG 6000 in Handizi and Kunlun 12, but at 20% PEG 6000 in Dama. Compared to the expression levels in 1% PEG, the highest transcription levels of HVA1 were increased by 803-, 490- and 323-fold respectively (Figure 4B). The range of HVA1 expression level in Handizi was wider than Kunlun 12 and Dama (Figure 4C). In addition, we tested the expression level of HVA1 from 8 cultivars with 25% PEG 6000 treatment by qPCR. The expression level of HVA1 increased from breed number 1 (Dama) to number 28 (Handizi) (Figure 4D). The difference of expression levels among the 8 cultivars was significant (P<0.01).

Discussion

Previous research demonstrated that a low PEG concentration promoted seed germination, seedling growth and improvement in the physiological function of hulless barley, while a high PEG concentration inhibited these functions (Yao and Wu, 2012). In this study we found that a low PEG concentration increased soluble protein content, but also decreased relative conductivity and malondialdehyde content. PEG 6000 is a non-ionic, water-soluble polymer, which does not rapidly penetrate intact plant tissues (Chazen et al., 1995). High MW PEG (6000-8000) is recommended for use in nutrient culture (Comeau et al., 2010; Blum, 2008). Therefore, it was reasonable to use PEG 6000 as an osmotic agent. The functional roles and mechanisms of LEAs remain unclear. This drought-related candidate gene might be involved in plant adaptation to drought stress. It was identified through QTL analysis of Tadmor and ER/Apm Recombinant Inbreed Line (RIL) populations (Du et al., 2004; Cseri et al., 2011). Under both salinity and drought stress, transgenic HVA1 mulberry plants showed improved cellular membrane stability (CMS), higher photosynthetic yield, less photo-oxidative damage, and better water use efficiency compared to the non-transgenic plants (Lal et al., 2008). When the HVA1 was transferred into maize, the transgenic plants had increased leaf relative water content (RWC), greater leaf and root biomass, and increased survival under complete 15 d drought while all wild-type non-transgenic control plants died (Nguyen and Sticklen, 2013). In malting barley genotypes, CO2 assimilation rates and PSII efficiency in drought conditions were related to both water content and the accumulation of HVA1 transcript in leaves (Rapacz et al., 2010). However, another group 3 LEA gene PcC3-06, isolated from Craterostigma plantagineum, failed to improve the drought resistance ability of transgenic tobacco (Hong et al., 1992). Accordingly, is there a link between HVA1 and drought stress in hulless barley? What is the mechanism of HVA1 in drought tolerance of hulless barley? Drought tolerance in barley was highly correlated with HVA1 (Qian et al., 2007; Wojcik-Jagła et al., 2012). Our results also show this positive correlation. Variation in the drought resistance of hulless barley was caused by amino acid changes in HVA1 (Qian et al., 2007). In this study, we selected three drought resistant cultivars from among 28 hulless barley cultivars according to their relative water content and dehydration rate. Then, we cloned HVA1s from the three cultivars, which were highly homologous at nucleotide and amino acid level with over 99% identities. We found that the expression level of the HVA1 in drought-resistant cultivars was higher than expression in drought-sensitive hulless barley under the same water stress. Therefore, we suggest that different HVA1 expression levels caused different levels of drought resistance in the three cultivars.

LEA protein is widely distributed in cells and plays an important role in stabilising cell membranes as a molecular barrier, combining ions, and protecting cells from oxidation. These functions are necessary for plant survival under high stress levels (Baker et al., 1988). LEA protein may also be a regulatory protein involved in plant osmotic adjustment and it may protect the endosperm and growing tissue from osmotic stress (Brini et al., 2007). Therefore, the protein produced by the HVA1 is involved in osmotic regulation, possibly by protecting membranes from instability when the plant experiences water stress. The expression of the HVA1 in hulless barley initially increased with an increase in osmotic stress, but decreased under prolonged stress. The reason might be that during the initial stages of the drought, plants need substantial LEA protein in order to rapidly stabilise and repair cytomembranes. Under continued water stress, the metabolic system of the plant may restrict the expression of the HVA1. This hypothesis was supported by qPCR results. Handizi had greater tolerance to PEG 6000 than Kunlun 12 and Dama. Compared to the expression levels in 1% PEG, the transcription levels of HVA1 at its highest point increased by 803-, 490- and 323-fold in Handizi, Kunlun12, and Dama, respectively. However, the highest transcription levels in Handizi and Kunlun 12 were at 25% PEG 6000; in Dama highest transcription was at 20% PEG 6000. Also, based on regression formula extrapolation, HVA1 was no longer expressed in 53.97% PEG 6000 in Handizi, 45.88% PEG 6000 in Kunlun 12, and 40.70% PEG 6000 in Dama.

Conclusions

Coping with the variability of biotic and abiotic stresses is essential in sustainable agriculture. Conventional breeding approaches can be used to develop improved varieties of hulless barley but the long time required supports the additional use of more precise biotechnological approaches. Genetic engineering techniques hold great promise for developing crop cultivars with drought tolerance (Checker et al., 2012). Understanding the mechanisms behind stress tolerance in crops under realistic conditions could accelerate drought resistance improvements in hulless barley. This study offers a process for identifying favorable cultivars and genetic controls of drought resistance in hulless barley. Drought resistance of plants is a quantitative character controlled by many genes, such as OjERF (Li et al., 2012) and Dhn (Saibi et al., 2015), but the HVA1 appears to be a key component. Knowledge of the expression level of the HVA1 under drought stress might be useful for breeding hulless barley with enhanced drought tolerance, but the interactions between HVA1 and other drought resistance genes require further studies.

Acknowledgments

We acknowledge financial support from the Natural Science Foundation of China (31160284, 31660388) and the China Agriculture Research System (CARS-05).

References

1 

RC Babu, J Zhang, A Blum, THD Ho, R Wu, H Nguyen, 2004. HVA1, a LEA gene from barley confers dehydration tolerance in transgenic rice (Oryza sativa L.) via cell membrane protection. Plant. Sci. 166:855-62.

2 

J Baker, C Van dennSteele, III L Dure, 1988. Sequence and characterization of 6 Lea proteins and their genes from cotton. Plant. Mol. Biol. 11:277-91.

3 

M Battaglia, Y Olvera-Carrillo, A Garciarrubio, F Campos, AA Covarrubias, 2008. The enigmatic LEA proteins and other hydrophilins. Plant. Physiol. 148:6-24.

4 

A Blum, 2008. Use of PEG to induce and control plant water deficit in experimental hydroponics culture. Available from: http://www.plantstress.com/methods/peg.htm

5 

MM Bradford, 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-54.

6 

F Brini, M Hanin, V Lumbreras, I Amara, H Khoudi, A Hassairi, M Pages, K Masmoudi, 2007. Overexpression of wheat dehydrin DHN-5 enhances tolerance to salt and osmotic stress in Arabidopsis thaliana. Plant. Cell. Rep. 26:2017-26.

7 

S Chapotin, NM Holbrook, S Morse, M Gutierrez, 2003. Water relations of tropical dry forest flowers: pathways for water entry and the role of extracellular polysaccharides. Plant. Cell. Environ. 26:623-30.

8 

H Chauhan, P Khurana, 2011. Use of doubled haploid technology for development of stable drought tolerant bread wheat (Triticum aestivum L.) transgenics. Plant. Biotechnol. J. 9:408-17.

9 

O Chazen, W Hartung, P Neumann, 1995. The different effects of PEG 6000 and NaCI on leaf development are associated with differential inhibition of root water transport. Plant. Cell. Environ. 18:727-35.

10 

VG Checker, AK Chhibbar, P Khurana, 2012. Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress. Transgenic. Res. 21:939-57.

11 

A Comeau, L Nodichao, J Collin, M Baum, J Samsatly, D Hamidou, F Langevin, A Laroche, E Picard, 2010. New approaches for the study of osmotic stress induced by polyethylene glycol (PEG) in cereal species. Cereal. Res. Commun. 38:471-81.

12 

A Cseri, M Cserhati, Korff M Von, B Nagy, GV Horvath, A Palagyi, J Pauk, D Dudits, O Torjek, 2011. Allele mining and haplotype discovery in barley candidate genes for drought tolerance. Euphytica 181:341-56.

13 

JY Du, XY Chen, W Li, Q Gao, 2004. Osmoregulation mechanism of drought stress and genetic engineering strategies for improving drought resistance in plants. J. For. Res. 6:56-62.

14 

B Hong, R Barg, T-HD Ho, 1992. Developmental and organ-specific expression of an ABA-and stress-induced protein in barley. Plant. Mol. Biol. 18:663-74.

15 

A Karami, M Shahbazi, V Niknam, ZS Shobbar, RS Tafreshi, R Abedini, HE Mabood, 2013. Expression analysis of dehydrin multigene family across tolerant and susceptible barley (Hordeum vulgare L.) genotypes in response to terminal drought stress. Acta Physiol. Plant. 35:2289-97.

16 

S Lal, V Gulyani, P Khurana, 2008. Overexpression of HVA1 gene from barley generates tolerance to salinity and water stress in transgenic mulberry (Morus indica). Transgenic. Res. 17:651-63.

17 

C Li, LB Han, X Zhang, 2012. Enhanced drought tolerance of tobacco overexpressing OJERF gene is associated with alteration in proline and antioxidant metabolism. J. Amer. Soc. Hort. Sci. 137:107-13.

18 

N Li, Q Zhao, J Huang, YJ Zhao, SH Zhang, 2007. Research on the transformation and expression of HVA1 gene from sixrow barley in tobacco. Biotechnol. Bull. 4:139-44.

19 

Y Li, W Chen, J Chen, H Shi, 2016. Vulnerability to droughtinduced cavitation in shoots of two typical shrubs in the southern Mu Us Sandy Land, China. J. Arid Land. 8:125-37.

20 

J Liang, M Zhou, X Zhou, Y Jin, M Xu, J Lin, 2013. JcLEA, a novel LEA-like protein from Jatropha curcas, confers a high level of tolerance to dehydration and salinity in Arabidopsis thaliana. PLoS One 8:e83056.

21 

JJ Liang, GD Deng, H Long, ZF Pan, CP Wang, P Cai, DL Xu, ZX Nima, MQ Yu, 2012. Virus-induced silencing of genes encoding LEA protein in Tibetan hulless barley (Hordeum vulgare ssp. vulgare) and their relationship to drought tolerance. Mol. Breed. 30:441-51.

22 

TX Nguyen, M Sticklen, 2013. Barley HVA1 gene confers drought and salt tolerance in transgenic maize (Zea mays L.). Adv. Crop. Sci. Tech. 1:2.

23 

HF Oraby, CB Ransom, AN Kravchenko, MB Sticklen, 2005. Barley gene confers salt tolerance in R3 transgenic oat. Crop. Sci. 45:2218-27.

24 

SH Park, SS Jun, G An, YN Hong, MC Park, 2003. A comparative study on the protective role of trehalose and LEA proteins against abiotic stresses in transgenic Chinese cabbage (Brassica campestris) overexpressing CaLEA orotsA. J. Plant. Biol. 46:277-86.

25 

MW Pfaffl, 2001. A new mathematical model for relative quantification in real-time RT–PCR. Nucl. Acid. Res. 29:e45.

26 

G Qian, ZX Han, T Zhao, GB Deng, ZF Pan, MQ Yu, 2007. Genotypic variability in sequence and expression of HVA1 gene in Tibetan hulless barley, Hordeum vulgare ssp. vulgare, associated with resistance to water deficit. Crop Pasture Sci. 58:425-31.

27 

S Ramanjulu, D Bartels, 2002. Drought-and desiccation-induced modulation of gene expression in plants. Plant Cell Environ. 25:141-51.

28 

M Rapacz, J Kościelniak, B Jurczyk, A Adamska, M Wojcik, 2010. Different patterns of physiological and molecular response to drought in seedlings of malt-and feed-type barleys (Hordeum vulgare). J. Argon. Crop Sci. 196:9-19.

29 

J Romanek, H Walczak, M Wojcik-Jagła, B Jurczyk, M Rapacz, 2011. The effect of simulated drought on HVA1 and SRG6 gene expression in spring barley. Biotechnology 14:4.

30 

W Saibi, M Drira, I Yacoubi, K Feki, F Brini, 2015. Empiric, structural and in silico findings give birth to plausible explanations for the multifunctionality of the wheat dehydrin (DHN-5). Acta Physiol. Plant. 37:1-8.

31 

E Sivamani, A Bahieldin, JM Wraith, T Al-Niemi, WE Dyer, THD Ho, R Qu, 2000. Improved biomass productivity and water use efficiency under water deficit conditions in transgenic wheat constitutively expressing the barley HVA1 gene. Plant Sci. 155:1-9.

32 

MJ Wise, 2003. LEAping to conclusions: a computational reanalysis of late embryogenesis abundant proteins and their possible roles. BMC Bioinform. 4:52.

33 

M Wojcik-Jagła, M Rapacz, W Barcik, F Janowiak, 2012. Differential regulation of barley (Hordeum distichon) HVA1 and SRG6 transcript accumulation during the induction of soil and leaf water deficit. Acta Physiol. Plant. 34:2069-78.

34 

XH Yao, KL Wu, 2012. Effect of PEG pretreatment on germination and growth physiology of hulless barley. Acta Bot. Boreali-Occidential. Sin. 7:1403-11.

Figure 1.

Resistance against water loss. A) Relative water content and dehydration rate of different varieties of hulless barley. The breed number indicates the different barley variety. B) The relationship between leaf relative water content of Kunlun 12 and polyethylene glycol (PEG) concentration. C) The relationship between leaf abscisic acid content of Kunlun 12 and PEG concentration. Error bars indicate the mean±standard deviation from three independent experiments.

ija-12-4-804-g001.jpg
Figure 2.

Drought resistance of Handizi, Kunlun12 and Dama. Effect of polyethylene glycol 6000 on leaf soluble protein content (A), relative conductivity (B) and malondialdehyde content (C) in Handizi, Kunlun 12 and Dama. Error bars indicate the mean±standard deviation from three independent experiments. Different letters indicate significant (P<0.05) differences between cultivars.

ija-12-4-804-g002.jpg
Figure 3.

Multiple alignments of the HVA1 deduced amino acid sequences from Handizi, Kunlun 12 and Dama. The sequences were aligned using the ClustalW programme.

ija-12-4-804-g003.jpg
Figure 4.

Expression levels of HVA1 in hulless barley. Values for quantitative polymerase chain reaction are means±standard deviation of five replicates. Different letters indicate significant (P<0.05) differences between treatments. A) Relative expression levels of HVA1 in Handizi, Kunlun 12 and Dama tested by RT-PCR. 1-7, Expression levels of β-Actin under PEG 6000 (0, 5, 10, 15, 20, 25 and 30%); a-g, expression levels of HVA1 under PEG 6000 (0, 5, 10, 15, 20, 25 and 30%); M, marker. B) Relative expression levels of HVA1 in Handizi, Kunlun 12 and Dama tested by quantitative real-time polymerase chain reaction (qRT-PCR). C) Expression profiling of HVA1 under PEG 6000. D) Relative expression levels of HVA1 in eight cultivars tested by qRT-PCR.

ija-12-4-804-g004.jpg
Table 1.

Names and sources of the hulless barley cultivars used in this study.

Number Name Source Number Name Source
1 Dama Gansu 15 GolasCley Mexico
2 Ganziheiliuleng Sichuan 16 Xiang 84-26-174 Hunan
3 Sunong 401 Jiangsu 17 Zangqing 80 Xizang
4 Xiang 1146 Hunan 18 Sunjiazhuangbai Gansu
5 Crime Mexico 19 Minxian Sichuan
6 9748 Gansu 20 Dulihuang Gansu
7 Daimao Sichuan 21 Changshengzi Gansu
8 Aba 330 Sichuan 22 Dagestam Mexico
9 Kunlun 10 Xining 23 Rudong 4 Jiangsu
10 Beiqing 1 Qinghai 24 Beiqing 3 Qinghai
11 Lasagoumang Xizang 25 Gaoyuanzao 1 Qinghai
12 Kunlun 12 Xining 26 Hor1726 Mexico
13 Kangqing 7 Sichuan 27 Liulengtou Gansu
14 Xiang 0888 Hunan 28 Handizi Sichuan
Table 2.

Sequences of primers used in this study.

Name Sequence
P1 F:5 - TTTGGATCCATGGCCTCCAACCAGAACC -3
P2 R: 5 - GGGGAGCTCCGAACGACCAAACACGACT -3
P3 F: 5 - TCACGCTCAAGTACCCCATCGA -3
P4 R: 5 - GGAGCTGTTCTTGGCAGTCTCCA -3
F: 5 - GCAGCGTCCTCCAGCA -3
R: 5 - GGTGTTGTCCCCTCCCA -3
F: 5 - CAAGTATGTCATAGAGATTTGAA -3
R: 5 - GTAACCGAAGTCACAAATCT -3
Abstract views:
294

Views:
PDF
68
HTML
54

Article Metrics

Metrics Loading ...

Metrics powered by PLOS ALM


Copyright (c) 2017 xiaohua yao

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.
 
© PAGEPress 2008-2018     -     PAGEPress is a registered trademark property of PAGEPress srl, Italy.     -     VAT: IT02125780185